EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:113368934-113369547]
Chromosome characteristics of ZNF274[chr1:113368934-113369547]
Back to top
Enhancers possibly regulated by ZNF274[chr1:113368934-113369547]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 113358625 113372306 enh12151
Bone Marrow (K562) Brain (SK-N-MC) Large Intestine Astrocyte Bone (Osteoblast) Placenta Spleen Neural Stem Cells (H9) Heart
chr1 113369203 113369427 vista2984
VISTA
SNP sites on ZNF274[chr1:113368934-113369547]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 113368997 rs112440674 T C 566277
chr1 113369045 rs191085069 C A 566278
chr1 113369127 rs571094705 C A 566279
chr1 113369243 rs577813084 GTCCTGCTACATTTCTTGGT G 566280
chr1 113369253 rs182494285 A G 566281
chr1 113369282 rs79004809 G A 566282
chr1 113369346 rs572425177 C T 566283
chr1 113369412 rs563265215 G T 566284
Genes possibly regulated by ZNF274[chr1:113368934-113369547]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:113368934-113369547]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results