Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 113358625 113372306 enh12151
chr1 113369203 113369427 vista2984

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 113369243 rs577813084 GTCCTGCTACATTTCTTGGT G 566280
chr1 113369253 rs182494285 A G 566281
chr1 113369282 rs79004809 G A 566282
chr1 113369346 rs572425177 C T 566283

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results