EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr1:117365752-117368674]
Chromosome characteristics of ZNF143[chr1:117365752-117368674]
Back to top
Enhancers possibly regulated by ZNF143[chr1:117365752-117368674]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 117365325 117372135 enh27102
Bone Marrow (K562) Brain (SK-N-SH) Large Intestine Blood (T-cell) Astrocyte Muscle (A673) Peripheral Blood (MM.1S) Muscle (Myoblast) Pancreas Uterus Thymus
chr1 117367696 117367920 vista3085
VISTA
chr1 117368438 117368774 vista3086
VISTA
SNP sites on ZNF143[chr1:117365752-117368674]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 117365787 rs556492260 A G 591756
chr1 117365791 rs538968685 T G 591757
chr1 117365866 rs113918946 G C 591758
chr1 117365934 rs576468264 C T 591759
chr1 117365958 rs180677137 C A 591760
chr1 117366008 rs142857950 T C 591761
chr1 117366043 rs151068018 C T 591762
chr1 117366086 rs139672230 G C 591763
chr1 117366189 rs567215031 A G 591764
chr1 117366220 rs2797422 G A 591765
chr1 117366272 rs116368068 A T 591766
chr1 117366285 rs371667341 C T 591767
chr1 117366594 rs74431266 A G 591768
chr1 117366742 rs57413157 A G 591769
chr1 117366782 rs142065281 TCAAAAGGCAAATTTAGAGC T 591770
chr1 117366782 rs58992010 TCAAAAGGCAAATTTAGAGC T 591771
chr1 117366892 rs186191224 C T 591772
chr1 117366939 rs57065890 G A 591773
chr1 117367114 rs115739696 A G 591774
chr1 117367127 rs141897807 T A,C 591775
chr1 117367190 rs6428670 T C 591776
chr1 117367191 rs147083459 A C 591777
chr1 117367252 rs6428671 T C 591778
chr1 117367417 rs116588834 G T 591779
chr1 117367447 rs7533221 G T 591780
chr1 117367575 rs185526741 C T 591781
chr1 117367579 rs114352215 C T 591782
chr1 117367684 rs74535225 G T 591783
chr1 117367768 rs76981618 C T 591784
chr1 117367795 rs182684380 C T 591785
chr1 117367796 rs547060708 G A 591786
chr1 117367809 rs369830631 T A 591787
chr1 117367810 rs185903014 T A 591788
chr1 117367950 rs2767329 A G 591789
chr1 117367958 rs149197314 C G 591790
chr1 117368112 rs529317389 C T 591791
chr1 117368198 rs2767330 G A 591792
chr1 117368368 rs576455670 T A 591793
chr1 117368377 rs540605794 C A 591794
chr1 117368511 rs563688398 T C 591795
chr1 117368515 rs111943868 A G 591796
chr1 117368519 rs141628076 C T 591797
chr1 117368597 rs73009101 A G 591798
chr1 117368622 rs183859111 C T 591799
Genes possibly regulated by ZNF143[chr1:117365752-117368674]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr1:117365752-117368674]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results