Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 156419365 156433115 enh657
chr1 156426931 156427503 vista3458

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 156426465 rs199607545 AG A 648509
chr1 156426574 rs532602661 T TTGGCTGATGATTCCGTCTGCCAC 648510
chr1 156426602 rs540589413 A T 648511
chr1 156426635 rs61324089 C G 648512
chr1 156426738 rs57295445 G T 648513
chr1 156426831 rs148517389 A G 648514
chr1 156426998 rs146098027 C T 648515

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results