EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:167632859-167637787]
Chromosome characteristics of ZNF274[chr1:167632859-167637787]
Back to top
Enhancers possibly regulated by ZNF274[chr1:167632859-167637787]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 167635443 167657337 enh718
Liver Blood (OCI-LY7) Blood (GM12878) Stomach Placenta Blood (Karpas-422) Muscle (Myoblast) Heart
chr1 167635730 167635903 vista3782
VISTA
SNP sites on ZNF274[chr1:167632859-167637787]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 167633063 rs139903294 A G 704152
chr1 167633064 rs17479266 C A 704153
chr1 167633133 rs540072350 A G 704154
chr1 167633179 rs184744829 A G 704155
chr1 167633270 rs41270726 G T 704156
chr1 167633592 rs79887819 G C 704157
chr1 167633687 rs79331563 T C 704158
chr1 167633759 rs76361175 A C 704159
chr1 167633824 rs576191083 G A 704160
chr1 167633832 rs150652394 G A 704161
chr1 167633843 rs139770235 A C 704162
chr1 167633861 rs35790932 G A 704163
chr1 167633977 rs111875364 A G 704164
chr1 167634041 rs567947521 C T 704165
chr1 167634045 rs184564027 G A 704166
chr1 167634067 rs1235335 A G 704167
chr1 167634072 rs189237395 T G 704168
chr1 167634111 rs182391316 T C 704169
chr1 167634118 rs140419214 A C 704170
chr1 167634230 rs111262592 G A 704171
chr1 167634234 rs560305780 C T 704172
chr1 167634572 rs1229370 G A 704173
chr1 167634584 rs3979128 TTGTC T 704174
chr1 167634584 rs77699159 TTGTC T 704175
chr1 167634606 rs140835735 A G 704176
chr1 167634645 rs79437549 A G 704177
chr1 167634718 rs114669191 A G 704178
chr1 167634725 rs538931773 T C 704179
chr1 167634735 rs78289721 G A 704180
chr1 167634872 rs79284911 A G 704181
chr1 167635094 rs185364582 T A 704182
chr1 167635187 rs12736872 T C 704183
chr1 167635194 rs140154208 G A 704184
chr1 167635210 rs150249673 G A 704185
chr1 167635214 rs139217866 A T 704186
chr1 167635251 rs572136717 G A 704187
chr1 167635263 rs554012573 G A 704188
chr1 167635304 rs572416779 C A 704189
chr1 167635331 rs1229369 A G 704190
chr1 167635504 rs34398230 T C 704191
chr1 167635557 rs6685521 C T 704192
chr1 167635575 rs1229368 A G 704193
chr1 167635629 rs147123587 T G 704194
chr1 167635752 rs138536493 C A,G,T 704195
chr1 167635771 rs74379355 A G 704196
chr1 167635822 rs74548778 C T 704197
chr1 167635829 rs74680680 C A,G 704198
chr1 167635879 rs541014098 G T 704199
chr1 167635964 rs144197622 C T 704200
chr1 167635968 rs570201215 A G 704201
chr1 167636340 rs545815429 CCATTGTAGCTGAGTAGGCTTCAAGGGAGGGGGCCGCCT C 704202
chr1 167636560 rs7542207 C T 704203
chr1 167636561 rs543225931 G A,T 704204
chr1 167636659 rs12073030 A G 704205
chr1 167636814 rs141449515 T C 704206
chr1 167637006 rs55856911 A G 704207
chr1 167637050 rs59492933 A G,T 704208
chr1 167637072 rs150776919 T C 704209
chr1 167637255 rs1229367 T A,C 704210
chr1 167637320 rs112738695 G C 704211
chr1 167637357 rs139333861 C T 704212
chr1 167637415 rs187007230 G A,T 704213
chr1 167637424 rs191753900 C A,G,T 704214
chr1 167637524 rs58844384 G A 704215
chr1 167637633 rs1229366 G A 704216
chr1 167637724 rs77849751 A T 704217
chr1 167637763 rs1229365 A G 704218
chr1 167637767 rs117089230 C A 704219
Genes possibly regulated by ZNF274[chr1:167632859-167637787]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:167632859-167637787]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results