EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr1:179144369-179145127]
Chromosome characteristics of ZBTB33[chr1:179144369-179145127]
Back to top
Enhancers possibly regulated by ZBTB33[chr1:179144369-179145127]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 179142225 179150396 enh27288
Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-MC) Prostate (RWPE1) Esophagus Astrocyte Lung (PC-9) Uterus
chr1 179144823 179145001 vista4051
VISTA
SNP sites on ZBTB33[chr1:179144369-179145127]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 179144425 rs547260292 G GATGTCAATGCCAGAGAGAGAAA 759150
chr1 179144640 rs111776576 T C 759151
chr1 179144715 rs566208171 T G 759152
chr1 179144973 rs115071556 C T 759153
chr1 179144985 rs559815338 T C 759154
chr1 179145014 rs75067329 G A 759155
chr1 179145053 rs562223187 C T 759156
chr1 179145069 rs145407116 C T 759157
Genes possibly regulated by ZBTB33[chr1:179144369-179145127]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr1:179144369-179145127]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results