Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 179555221 179555646 vista4058

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 179555365 rs6677468 C T 760451
chr1 179555385 rs6677476 C G 760452
chr1 179555431 rs200622406 CGCTCGGAGCTCGGA C 760453
chr1 179555431 rs564934724 C CGCTCGGA 760454
chr1 179555431 rs879901572 C CGCTCGGA 760455
chr1 179555486 rs78429855 G A 760456
chr1 179555576 rs186171834 G T 760457
chr1 179555619 rs116481161 C T 760458
chr1 179555725 rs527722462 CGCCTACTCCACCCGCGCCTTTCTCGA C 760459
chr1 179555764 rs569843905 C A 760460
chr1 179555798 rs538673375 G A 760461

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 179560748 179660407 + TDRD5 ENSG00000162782.11 179560748 0.94 0.99 4941 1611


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results