Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 179555221 179555646 vista4058

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 179555486 rs78429855 G A 760456
chr1 179555576 rs186171834 G T 760457
chr1 179555619 rs116481161 C T 760458
chr1 179555725 rs527722462 CGCCTACTCCACCCGCGCCTTTCTCGA C 760459

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results