EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr1:185373619-185374508]
Chromosome characteristics of ZBTB33[chr1:185373619-185374508]
Back to top
Enhancers possibly regulated by ZBTB33[chr1:185373619-185374508]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 185366465 185375544 enh27318
Prostate (RWPE1) Astrocyte Bone (Osteoblast) Muscle (Myoblast) Muscle (Myotube) Neural Stem Cells (H9)
chr1 185374355 185374736 vista4261
VISTA
SNP sites on ZBTB33[chr1:185373619-185374508]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 185373681 rs11267171 C CCA,CCACACACACAACACATACA,CCACACACACAACACATACACACACACA 792531
chr1 185373681 rs397982262 C CCA 792532
chr1 185373928 rs149319317 A AT 792533
chr1 185373932 rs185787152 T C 792534
chr1 185373936 rs12403670 G C 792535
chr1 185373938 rs12406094 A G 792536
chr1 185374301 rs181722637 T C 792537
chr1 185374303 rs184152354 A T 792538
chr1 185374311 rs545816454 C T 792539
chr1 185374411 rs567923257 G A 792540
Genes possibly regulated by ZBTB33[chr1:185373619-185374508]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr1:185373619-185374508]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results