EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr1:212311819-212312079]
Chromosome characteristics of ZZZ3[chr1:212311819-212312079]
Back to top
Enhancers possibly regulated by ZZZ3[chr1:212311819-212312079]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 212309905 212317244 enh58215
Skin (Keratinocyte) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Epithelial (MCF-7)
chr1 212311960 212312104 vista4989
VISTA
SNP sites on ZZZ3[chr1:212311819-212312079]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 212311949 rs536347395 CTGCCCGGTCACTAGGCTCCTCA C 920752
chr1 212311949 rs538170849 C G 920753
Genes possibly regulated by ZZZ3[chr1:212311819-212312079]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr1:212311819-212312079]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results