Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 230561990 230562633 vista5500

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 230562286 rs373904174 T C 1017633
chr1 230562300 rs182403984 C G 1017634
chr1 230562318 rs535011789 C T 1017635
chr1 230562367 rs547220075 GGGGACCC G 1017636
chr1 230562416 rs537515890 C G,T 1017637
chr1 230562419 rs556411801 T A,C,G 1017638
chr1 230562419 rs557862089 T TC 1017639
chr1 230562434 rs372317094 C G,T 1017640
chr1 230562503 rs534341503 A C 1017641
chr1 230562539 rs113014513 C A,G 1017642
chr1 230562553 rs539004401 T TGCTGCCGAGGTTTCCTGGGGGTC 1017643
chr1 230562658 rs111780057 C T 1017644
chr1 230562672 rs563574626 T C 1017645
chr1 230562760 rs187948353 C G 1017646

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 230457392 230561475 - PGBD5 ENSG00000177614.5 230561475 0.76 0.98 636 1938


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results