EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr10:22726020-22726215]
Chromosome characteristics of ZZZ3[chr10:22726020-22726215]
Back to top
Enhancers possibly regulated by ZZZ3[chr10:22726020-22726215]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 22720787 22729775 enh57537
Prostate (PC-3) Prostate (RWPE1) Bone (Osteoblast) Lung (A549) Colon (HCT116) Lung (PC-9) Muscle (Myoblast) Uterus
chr10 22725331 22726270 vista6766
VISTA
SNP sites on ZZZ3[chr10:22726020-22726215]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 22726022 rs116640315 C A 1258585
chr10 22726033 rs148567086 A G 1258586
chr10 22726038 rs191311275 C T 1258587
chr10 22726046 rs114186103 C T 1258588
chr10 22726093 rs73598518 A C,G 1258589
chr10 22726167 rs147456541 CTCTGGTTTCTGTGGTATCGGCT C 1258590
chr10 22726167 rs371318971 CTCTGGTTTCTGTGGTATCGGCT C 1258591
chr10 22726213 rs373228744 A T 1258592
Genes possibly regulated by ZZZ3[chr10:22726020-22726215]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr10:22726020-22726215]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results