EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr10:22726080-22726444]
Chromosome characteristics of ZZZ3[chr10:22726080-22726444]
Back to top
Enhancers possibly regulated by ZZZ3[chr10:22726080-22726444]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 22720787 22729775 enh57537
Prostate (PC-3) Prostate (RWPE1) Bone (Osteoblast) Lung (A549) Colon (HCT116) Lung (PC-9) Muscle (Myoblast) Uterus
chr10 22725331 22726270 vista6766
VISTA
SNP sites on ZZZ3[chr10:22726080-22726444]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 22726093 rs73598518 A C,G 1258589
chr10 22726167 rs147456541 CTCTGGTTTCTGTGGTATCGGCT C 1258590
chr10 22726167 rs371318971 CTCTGGTTTCTGTGGTATCGGCT C 1258591
chr10 22726213 rs373228744 A T 1258592
chr10 22726233 rs73598519 G A 1258593
chr10 22726257 rs544684680 C T 1258594
chr10 22726269 rs558500899 C T 1258595
chr10 22726342 rs545528499 G A 1258596
chr10 22726380 rs540414113 A C 1258597
chr10 22726395 rs1057183 G A 1258598
chr10 22726397 rs12268450 C T 1258599
chr10 22726420 rs142913720 C T 1258600
Genes possibly regulated by ZZZ3[chr10:22726080-22726444]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr10:22726080-22726444]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results