Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 23646720 23666660 enh58256
chr10 23665059 23665409 vista6795

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 23665091 rs555661907 C T 1263611
chr10 23665113 rs118071294 A C 1263612
chr10 23665147 rs567230152 AATGACTGATGTGAAACTTGTAAAT A 1263613
chr10 23665217 rs191351306 A G 1263614
chr10 23665280 rs562707940 G A 1263615
chr10 23665296 rs78197994 T G 1263616
chr10 23665407 rs568381491 T G 1263617
chr10 23665429 rs12254940 C T 1263618

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results