EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr10:23665138-23665296]
Chromosome characteristics of ZNF274[chr10:23665138-23665296]
Back to top
Enhancers possibly regulated by ZNF274[chr10:23665138-23665296]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 23646720 23666660 enh58256
Skin (Keratinocyte) Cervix (HeLa-S3) Brain (SK-N-MC) Prostate (RWPE1) Esophagus Blood (GM12878) Muscle (A673) Thyroid Peripheral Blood (MM.1S) Blood (T-cell) Heart
chr10 23665059 23665409 vista6795
VISTA
SNP sites on ZNF274[chr10:23665138-23665296]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 23665147 rs567230152 AATGACTGATGTGAAACTTGTAAAT A 1263613
chr10 23665217 rs191351306 A G 1263614
chr10 23665280 rs562707940 G A 1263615
chr10 23665296 rs78197994 T G 1263616
Genes possibly regulated by ZNF274[chr10:23665138-23665296]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr10:23665138-23665296]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results