EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr10:26738054-26739024]
Chromosome characteristics of ZNF143[chr10:26738054-26739024]
Back to top
Enhancers possibly regulated by ZNF143[chr10:26738054-26739024]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 26728565 26740997 enh1139
Blood (T-cell) Astrocyte Blood (OCI-LY7) Blood (GM12878) Peripheral Blood (MM.1S) Blood (Karpas-422) Thymus Stomach
chr10 26737474 26738103 vista6858
VISTA
SNP sites on ZNF143[chr10:26738054-26739024]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 26738167 rs11015115 G T 1277319
chr10 26738213 rs577474436 GGT G 1277320
chr10 26738221 rs12262799 T C 1277321
chr10 26738282 rs541202557 CT C 1277322
chr10 26738380 rs4601668 A G 1277323
chr10 26738515 rs7903528 G A 1277324
chr10 26738576 rs79183201 A G 1277325
chr10 26738681 rs534080964 G A 1277326
chr10 26738768 rs117789818 G C 1277327
chr10 26738800 rs7907042 G A 1277328
chr10 26738889 rs7908121 C T 1277329
chr10 26738926 rs538942806 CCCTGTCTTAAAAAAAAAAGTGCTTGAGTATCAGCAACAT C 1277330
chr10 26739018 rs4749137 A G 1277331
Genes possibly regulated by ZNF143[chr10:26738054-26739024]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr10:26738054-26739024]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results