EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr10:94608748-94609118]
Chromosome characteristics of ZZZ3[chr10:94608748-94609118]
Back to top
Enhancers possibly regulated by ZZZ3[chr10:94608748-94609118]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 94608884 94609046 vista8341
VISTA
SNP sites on ZZZ3[chr10:94608748-94609118]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 94608815 rs530544366 G C 1583553
chr10 94608860 rs532782003 C A,T 1583554
chr10 94608925 rs61860812 C T 1583555
chr10 94608939 rs2497331 C G 1583556
chr10 94608946 rs557999303 CGAGAAGAGAGCGTGGGCTG C 1583557
chr10 94609060 rs192592253 G A 1583558
chr10 94609104 rs2490732 A G 1583559
Genes possibly regulated by ZZZ3[chr10:94608748-94609118]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr10:94608748-94609118]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results