EnhancerDB
  1. Home
  2. TFBS
  3. AR[chr11:10617801-10619141]
Chromosome characteristics of AR[chr11:10617801-10619141]
Back to top
Enhancers possibly regulated by AR[chr11:10617801-10619141]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 10614105 10621835 enh13760
Placenta Stomach
chr11 10618515 10618559 vista9625
VISTA
SNP sites on AR[chr11:10617801-10619141]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 10617822 rs193259410 C A 1842114
chr11 10617832 rs113487802 A G 1842115
chr11 10618034 rs75278236 T C 1842116
chr11 10618126 rs184141099 A C 1842117
chr11 10618213 rs73412002 C G 1842118
chr11 10618264 rs189520049 G C 1842119
chr11 10618285 rs75944272 T A 1842120
chr11 10618426 rs139627749 T C 1842121
chr11 10618515 rs75803303 T C 1842122
chr11 10618750 rs72862323 A C 1842123
chr11 10618765 rs116055980 A G 1842124
chr11 10618897 rs72862324 C G 1842125
chr11 10619041 rs114527818 T A 1842126
chr11 10619071 rs561918480 GGGTCTCACTTTGTTGCCCAGGCT G 1842127
Genes possibly regulated by AR[chr11:10617801-10619141]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by AR[chr11:10617801-10619141]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results