Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 12217885 12225194 enh13778
chr11 12222498 12222995 vista9688

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 12222116 rs7110203 C G 1855091
chr11 12222143 rs539543759 G A 1855092
chr11 12222200 rs116593568 G A 1855093
chr11 12222268 rs79489595 G A 1855094
chr11 12222292 rs537837340 GTTTAGCCAAGAGAATCAGAAACTGTA G 1855095
chr11 12222313 rs139570850 A G 1855096
chr11 12222345 rs2013262 G A 1855097
chr11 12222359 rs562021476 T C 1855098
chr11 12222423 rs869123 A G 1855099
chr11 12222430 rs142874635 T C 1855100
chr11 12222561 rs114239583 C T 1855101

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results