Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 56670945 56681075 enh58349
chr11 56677602 56677921 vista10333

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 56677622 rs1792513 T C 2006583
chr11 56677704 rs67974266 AC A 2006584
chr11 56677792 rs554540634 C CCCCAGACCACCCACGGAGGTAAATGTCCT 2006585
chr11 56677835 rs374039689 G A 2006586
chr11 56677875 rs79625177 G A 2006587
chr11 56677987 rs11228838 A C 2006588
chr11 56677993 rs74909904 A G 2006589

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results