Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 63766025 63776443 enh43552
chr11 63775286 63775368 vista10550

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 63774989 rs560726374 C T 2037106
chr11 63775073 rs529958221 C T 2037107
chr11 63775101 rs320146 C T 2037108
chr11 63775530 rs479975 C G 2037109
chr11 63775532 rs12285283 C T 2037110
chr11 63775566 rs504060 T A 2037111
chr11 63775848 rs187208116 G A 2037112
chr11 63775873 rs147518923 G GAGGCGGGAGGTCCCACGCACACAT 2037113
chr11 63775873 rs6144369 G GAGGCGGGAGGTCCCACGCACACAT 2037114

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results