Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 121149909 121155815 enh62219
chr11 121153802 121153902 vista11826

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 121153455 rs10750182 A T 2315737
chr11 121153483 rs191236777 T C 2315738
chr11 121153507 rs145882478 C T 2315739
chr11 121153555 rs199849171 T TG 2315740
chr11 121153556 rs77726126 T G 2315741
chr11 121153557 rs183192049 T G 2315742
chr11 121153563 rs200890463 T TTG 2315743
chr11 121153602 rs143690746 G GAGTAGTAAC,GAGTAGTAACAGTAGTAACTGCTGTAAAGATGGTTTCAAGTAGTAAC 2315744
chr11 121153639 rs7950106 C T 2315745
chr11 121153731 rs565071297 A G 2315746

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results