EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr11:125241010-125241502]
Chromosome characteristics of ZNF274[chr11:125241010-125241502]
Back to top
Enhancers possibly regulated by ZNF274[chr11:125241010-125241502]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 125239640 125248575 enh29227
Ovary Astrocyte Bone (Osteoblast) Pancreas Muscle (Myotube) Uterus Thymus Heart
chr11 125241346 125241732 vista11977
VISTA
SNP sites on ZNF274[chr11:125241010-125241502]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 125241046 rs12273350 G A 2341053
chr11 125241079 rs533935753 C CTCAGATTAATGATTGCAGTCTAA 2341054
chr11 125241083 rs532026969 G A,T 2341055
chr11 125241083 rs562371524 G GA 2341056
chr11 125241177 rs73628705 G C 2341057
chr11 125241313 rs112044186 G C 2341058
chr11 125241483 rs140409385 A G 2341059
chr11 125241496 rs113935103 T G 2341060
Genes possibly regulated by ZNF274[chr11:125241010-125241502]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr11:125241010-125241502]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results