EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr12:51712544-51713204]
Chromosome characteristics of ZZZ3[chr12:51712544-51713204]
Back to top
Enhancers possibly regulated by ZZZ3[chr12:51712544-51713204]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 51708365 51716315 enh14717
Bone Marrow (K562) Cervix (HeLa-S3) Blood (T-cell) Esophagus Blood (OCI-LY7) Stomach Placenta Thymus Epithelial (MCF-7)
chr12 51712804 51712960 vista13397
VISTA
SNP sites on ZZZ3[chr12:51712544-51713204]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 51712680 rs549311042 TTTTGGTTTGGCCATATCTG T 2630689
chr12 51713051 rs76875296 C T 2630690
chr12 51713103 rs141254245 G A 2630691
chr12 51713183 rs7138394 T C 2630692
Genes possibly regulated by ZZZ3[chr12:51712544-51713204]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr12:51712544-51713204]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results