EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr12:52915298-52915524]
Chromosome characteristics of ZNF274[chr12:52915298-52915524]
Back to top
Enhancers possibly regulated by ZNF274[chr12:52915298-52915524]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 52915277 52915747 vista13480
VISTA
SNP sites on ZNF274[chr12:52915298-52915524]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 52915313 rs575671208 G C 2639562
chr12 52915400 rs139863285 TGCCAGCTGCTTTAGGGAGG T 2639563
chr12 52915400 rs372152833 TGCCAGCTGCTTTAGGGAGG T 2639564
chr12 52915432 rs73318304 C T 2639565
Genes possibly regulated by ZNF274[chr12:52915298-52915524]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 52908359 52914471 - KRT5 ENSG00000186081.7 52914471 0.99 0.99 827 12091
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr12:52915298-52915524]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results