Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 57361745 57374346 enh68740
chr14 57372112 57372414 vista17911

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 57372017 rs59093154 G A 3570100
chr14 57372036 rs72727532 A G 3570101
chr14 57372064 rs376212461 TAGG T 3570102
chr14 57372064 rs67436998 TAGG T 3570103
chr14 57372102 rs143164996 C T 3570104
chr14 57372114 rs71450310 C CAAG 3570105
chr14 57372353 rs542267546 C A 3570106
chr14 57372441 rs552387953 G GCTGCTTCTGCTGCTGCTACTA 3570107

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results