EnhancerDB
  1. Home
  2. TFBS
  3. MYOD[chr14:65005680-65006358]
Chromosome characteristics of MYOD[chr14:65005680-65006358]
Back to top
Enhancers possibly regulated by MYOD[chr14:65005680-65006358]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 65004205 65010668 enh89716
Uterus Bone (Osteoblast) Prostate (RWPE1)
chr14 65006188 65006351 vista18097
VISTA
SNP sites on MYOD[chr14:65005680-65006358]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 65005701 rs141097812 T C 3605224
chr14 65005767 rs141686218 A AC 3605225
chr14 65005844 rs547023123 G A 3605226
chr14 65006084 rs45544744 C T 3605227
chr14 65006239 rs188987399 A G 3605228
chr14 65006294 rs45486102 G GCCGCCACACCCCTGTCTGCCGTC 3605229
chr14 65006294 rs527795749 G GCCGCCACACCCCTGTCTGCCGTC 3605230
chr14 65006331 rs45472695 T C 3605231
Genes possibly regulated by MYOD[chr14:65005680-65006358]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MYOD[chr14:65005680-65006358]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results