Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 65004205 65010668 enh89716
chr14 65006188 65006351 vista18097

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 65006084 rs45544744 C T 3605227
chr14 65006239 rs188987399 A G 3605228
chr14 65006294 rs45486102 G GCCGCCACACCCCTGTCTGCCGTC 3605229
chr14 65006294 rs527795749 G GCCGCCACACCCCTGTCTGCCGTC 3605230
chr14 65006331 rs45472695 T C 3605231
chr14 65006399 rs45627137 GT G 3605232
chr14 65006449 rs45498699 G A 3605233

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results