EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr14:65224841-65225987]
Chromosome characteristics of ZNF274[chr14:65224841-65225987]
Back to top
Enhancers possibly regulated by ZNF274[chr14:65224841-65225987]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 65222685 65233155 enh15686
Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Brain (SK-N-SH) Esophagus Astrocyte Bone (Osteoblast) Muscle (A673) Placenta Colon (HCT116) Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Uterus Heart
chr14 65224783 65224915 vista18110
VISTA
SNP sites on ZNF274[chr14:65224841-65225987]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 65224959 rs141847395 T C 3606845
chr14 65224995 rs150583642 T C 3606846
chr14 65225032 rs558423842 C T 3606847
chr14 65225097 rs116716300 G T 3606848
chr14 65225142 rs139665307 G T 3606849
chr14 65225150 rs76420009 A G 3606850
chr14 65225251 rs146231956 G A 3606851
chr14 65225432 rs139307638 G A,C 3606852
chr14 65225449 rs540797185 A G 3606853
chr14 65225452 rs58725048 G A,C 3606854
chr14 65225681 rs74058211 G A 3606855
chr14 65225818 rs142075506 A G 3606856
chr14 65225907 rs558445738 A G 3606857
chr14 65225946 rs540834207 G C 3606858
chr14 65225947 rs11270591 AAGGCAGGGAGCCAAGTAGCT A 3606859
chr14 65225947 rs796423283 AAGGCAGGGAGCCAAGTAGCT A 3606860
Genes possibly regulated by ZNF274[chr14:65224841-65225987]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr14:65224841-65225987]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results