EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr14:104689599-104691155]
Chromosome characteristics of ZNF143[chr14:104689599-104691155]
Back to top
Enhancers possibly regulated by ZNF143[chr14:104689599-104691155]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 104683866 104698135 enh47819
Prostate (PC-3) Brain (SK-N-SH) Brain (SK-N-MC) Large Intestine Stomach Muscle (A673) Colon (HCT116) Pancreas Thymus Epithelial (MCF-7)
chr14 104690511 104690903 vista19229
VISTA
SNP sites on ZNF143[chr14:104689599-104691155]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 104689699 rs73362241 C T 3819952
chr14 104689705 rs369898118 C A 3819953
chr14 104689730 rs527246427 CCTGCCGCCCCCGCCCCCACCCCAG C 3819954
chr14 104689741 rs534999082 C T 3819955
chr14 104689764 rs558167841 C G 3819956
chr14 104689805 rs145179438 C T 3819957
chr14 104689808 rs541957193 CA C 3819958
chr14 104689911 rs200843229 G A 3819959
chr14 104690122 rs566976289 G A,T 3819960
chr14 104690154 rs529737775 G T 3819961
chr14 104690155 rs77505595 T G 3819962
chr14 104690313 rs79043514 CT C 3819963
chr14 104690408 rs530858453 ATACTT A 3819964
chr14 104690457 rs75538201 A G 3819965
chr14 104690493 rs74087236 G C 3819966
chr14 104690503 rs68036376 C A 3819967
chr14 104690555 rs74087237 G T 3819968
chr14 104690581 rs184929021 C T 3819969
chr14 104690685 rs77607062 C G 3819970
chr14 104690726 rs79120695 TG T 3819971
chr14 104690742 rs528645285 T A,C 3819972
chr14 104690861 rs564280074 GT G 3819973
chr14 104690916 rs536770429 C T 3819974
chr14 104690941 rs144246205 C T 3819975
chr14 104690982 rs558714365 C T 3819976
chr14 104690990 rs140679011 G A 3819977
chr14 104690997 rs74087238 C A,T 3819978
chr14 104691074 rs540340650 C T 3819979
chr14 104691078 rs559954133 G A 3819980
chr14 104691114 rs10083398 C T 3819981
Genes possibly regulated by ZNF143[chr14:104689599-104691155]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr14:104689599-104691155]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results