EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr15:99558445-99559045]
Chromosome characteristics of ZZZ3[chr15:99558445-99559045]
Back to top
Enhancers possibly regulated by ZZZ3[chr15:99558445-99559045]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 99554485 99565188 enh44220
Cervix (HeLa-S3) Prostate (RWPE1) Muscle (Myoblast) Pancreas (Panc1) Muscle (Myotube) Uterus
chr15 99559007 99559192 vista21408
VISTA
SNP sites on ZZZ3[chr15:99558445-99559045]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 99558634 rs73468258 C G 4223043
chr15 99558694 rs199834486 GCGCAGAGGTGGAGCGGGTCGGGGT G 4223044
chr15 99558703 rs529523822 T C 4223045
chr15 99558718 rs550958948 T G 4223046
chr15 99558902 rs8041756 G A 4223047
Genes possibly regulated by ZZZ3[chr15:99558445-99559045]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr15:99558445-99559045]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results