Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 2478608 2478672 vista21572

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 2478550 rs6600206 A T 4261621
chr16 2478602 rs566273888 C T 4261622
chr16 2478745 rs34401552 TC T 4261623
chr16 2478745 rs397855780 TC T 4261624
chr16 2478878 rs78443348 G A 4261625
chr16 2479061 rs59129256 C T 4261626
chr16 2479190 rs574419474 G A 4261627
chr16 2479213 rs79038845 T C 4261628
chr16 2479482 rs13331598 G C 4261629
chr16 2479507 rs530962466 G T 4261630
chr16 2479712 rs13337091 A C 4261631
chr16 2479718 rs558792335 C A 4261632
chr16 2479723 rs371813732 G A 4261633
chr16 2479773 rs571630614 AGCGATCCGGCGATCGGGTCCCGGGGCG A 4261634
chr16 2479800 rs192864152 G A 4261635
chr16 2479999 rs565045507 C T 4261636

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 2479395 2508855 + CCNF ENSG00000162063.8 2479395 0.93 1.0 612 14437


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 2495437 2495458 + hsa-miR-6767-3p MIMAT0027435 2479447 0.916667 0.0 560 591