EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr16:2885645-2886115]
Chromosome characteristics of TCF7L2[chr16:2885645-2886115]
Back to top
Enhancers possibly regulated by TCF7L2[chr16:2885645-2886115]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 2883745 2901765 enh16505
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Astrocyte Bone (Osteoblast) Stomach Placenta Colon (HCT116) Breast Lung (PC-9) Pancreas Pancreas (Panc1) Blood (T-cell) Epithelial (MCF-7)
chr16 2885761 2886144 vista21585
VISTA
SNP sites on TCF7L2[chr16:2885645-2886115]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 2885689 rs397707623 G GAAAGA 4264165
chr16 2885694 rs76693058 A G 4264166
chr16 2885924 rs8046328 C A,G 4264167
chr16 2885949 rs149987151 C T 4264168
chr16 2885953 rs117092165 C T 4264169
chr16 2885977 rs150378461 GCCA G 4264170
chr16 2886063 rs145179677 G C 4264171
chr16 2886086 rs376004372 GCAAGTTCAGAGACAAGGCATCGACTCACTA G 4264172
chr16 2886086 rs577002896 GCAAGTTCAGAGACAAGGCATCGACTCACTA G 4264173
Genes possibly regulated by TCF7L2[chr16:2885645-2886115]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr16:2885645-2886115]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results