Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 2883745 2901765 enh16505
chr16 2885761 2886144 vista21585

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 2885977 rs150378461 GCCA G 4264170
chr16 2886063 rs145179677 G C 4264171
chr16 2886086 rs376004372 GCAAGTTCAGAGACAAGGCATCGACTCACTA G 4264172
chr16 2886086 rs577002896 GCAAGTTCAGAGACAAGGCATCGACTCACTA G 4264173
chr16 2886116 rs113845517 A G 4264174

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results