Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 2950685 2956642 enh3849
chr16 2955389 2955781 vista21590

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 2955041 rs142616064 G A 4265042
chr16 2955057 rs577354868 C T 4265043
chr16 2955077 rs373182630 ACCTGTGGCTCCTCCAGCGG A 4265044
chr16 2955077 rs541822570 ACCTGTGGCTCCTCCAGCGG A 4265045
chr16 2955270 rs12932717 T G 4265046
chr16 2955295 rs7188530 C T 4265047
chr16 2955311 rs12925100 G A 4265048
chr16 2955327 rs146461180 A C 4265049
chr16 2955341 rs28494003 A T 4265050
chr16 2955358 rs139027248 G A 4265051
chr16 2955415 rs531925213 C A 4265052

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results