Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 3197245 3205042 enh3851
chr16 3202363 3202472 vista21606

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 3201937 rs139401984 G GA 4267463
chr16 3201937 rs35173797 G GA 4267464
chr16 3201947 rs75267048 G A 4267465
chr16 3201983 rs115233150 A C,G 4267466
chr16 3201985 rs149030215 C T 4267467
chr16 3201994 rs542682639 T TTGGGGTATCCTTCCACGGGG 4267468
chr16 3202017 rs142137747 G A,C 4267469
chr16 3202110 rs55704032 T A 4267470
chr16 3202164 rs540877415 G GT 4267471
chr16 3202278 rs2741894 A T 4267472
chr16 3202326 rs535118432 C G 4267473
chr16 3202335 rs115504041 C T 4267474
chr16 3202421 rs368234182 C A 4267475
chr16 3202433 rs527434922 C G,T 4267476

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results