EnhancerDB
  1. Home
  2. TFBS
  3. ZNF217[chr16:10961881-10962537]
Chromosome characteristics of ZNF217[chr16:10961881-10962537]
Back to top
Enhancers possibly regulated by ZNF217[chr16:10961881-10962537]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 10959105 10965258 enh3878
Blood (T-cell) Blood (OCI-LY7) Blood (GM12878) Stomach Peripheral Blood (MM.1S) Blood (Karpas-422) Thymus Heart
chr16 10962462 10962962 vista21818
VISTA
SNP sites on ZNF217[chr16:10961881-10962537]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 10961882 rs6498113 T G 4312173
chr16 10961904 rs185464843 C T 4312174
chr16 10962116 rs140192334 C CTGCCCAGGGGTGACGCAACT 4312175
chr16 10962165 rs112830707 G A 4312176
chr16 10962172 rs116554419 G T 4312177
chr16 10962352 rs8052438 A C 4312178
chr16 10962365 rs148665654 T A 4312179
Genes possibly regulated by ZNF217[chr16:10961881-10962537]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF217[chr16:10961881-10962537]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results