| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr16 | 20271496 | 20271863 | vista22093 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr16 | 20271734 | rs377347377 | C | T | 4365615 | |
| chr16 | 20271795 | rs368701199 | CTGGTGCCTTGGCACAGGAAATCCCT | C | 4365616 | |
| chr16 | 20271795 | rs372159422 | CTGGTGCCTTGGCACAGGAAATCCCT | C | 4365617 | |
| chr16 | 20271955 | rs185328469 | C | T | 4365618 | |
| chr16 | 20271957 | rs76989715 | G | C | 4365619 | |
| chr16 | 20272008 | rs138385697 | G | A | 4365620 | |
| chr16 | 20272153 | rs112568464 | T | C | 4365621 | |
| chr16 | 20272228 | rs10549196 | CAA | C | 4365622 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|