Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 20271496 20271863 vista22093

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 20271795 rs368701199 CTGGTGCCTTGGCACAGGAAATCCCT C 4365616
chr16 20271795 rs372159422 CTGGTGCCTTGGCACAGGAAATCCCT C 4365617
chr16 20271955 rs185328469 C T 4365618
chr16 20271957 rs76989715 G C 4365619
chr16 20272008 rs138385697 G A 4365620
chr16 20272153 rs112568464 T C 4365621
chr16 20272228 rs10549196 CAA C 4365622
chr16 20272288 rs116036006 G A,C 4365623
chr16 20272370 rs8051583 C T 4365624
chr16 20272375 rs546234588 T A,C 4365625

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results