Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 81453285 81472414 enh31955
chr16 81471494 81471714 vista23125

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 81470869 rs548561246 C G,T 4582529
chr16 81470870 rs541050367 CCTGTGGTCCCAGCTACTTGGGAGG C 4582530
chr16 81470911 rs569953479 G T 4582531
chr16 81470951 rs310015 G A 4582532
chr16 81471127 rs144656893 A C 4582533
chr16 81471141 rs310014 C T 4582534
chr16 81471218 rs143451600 G C 4582535
chr16 81471242 rs310013 T A,C 4582536
chr16 81471382 rs8044201 A G 4582537
chr16 81471520 rs530838741 T C 4582538
chr16 81471551 rs575604351 A G 4582539
chr16 81471594 rs139444860 C T 4582540
chr16 81471654 rs310011 A G 4582541

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 81644992 81645011 + hsa-miR-6504-3p MIMAT0025465 81478590 0.916667 0.0 6933 630