Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 84206965 84211115 enh99362
chr16 84210153 84210392 vista23232

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 84210095 rs548540321 TAGCCAGCCTGGGCCAGGAAGCCACCG T 4605169
chr16 84210095 rs66573559 TAGCCAGCCTGGGCCAGGAAGCCACCG T 4605170
chr16 84210148 rs200927009 TCTGA T 4605171
chr16 84210148 rs373225350 TCTGA T 4605172
chr16 84210162 rs577953347 G A,T 4605173
chr16 84210172 rs3743637 T G 4605174
chr16 84210319 rs183575008 C T 4605175
chr16 84210341 rs186877526 C T 4605176
chr16 84210369 rs149279818 G A 4605177

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results