Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 89242675 89243011 vista23553

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 89242746 rs550439064 G C 4673373
chr16 89242767 rs72819355 T C 4673374
chr16 89242770 rs113582471 C A,T 4673375
chr16 89242787 rs117217569 C T 4673376
chr16 89242872 rs77612535 G A 4673377
chr16 89242953 rs72819356 G A 4673378
chr16 89243027 rs8049644 T C 4673379
chr16 89243087 rs549191432 TGAAGGAGCTCAGGAGCAGGCCGCGAAGACGGTGATGTGGAGATGGG T 4673380

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results