EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:1509125-1509668]
Chromosome characteristics of ZNF274[chr17:1509125-1509668]
Back to top
Enhancers possibly regulated by ZNF274[chr17:1509125-1509668]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 1499092 1514135 enh16927
Liver (HepG2) Prostate (RWPE1) Bone (Osteoblast) Stomach Placenta Thyroid Heart Epithelial (MCF-7)
chr17 1509587 1509868 vista23663
VISTA
SNP sites on ZNF274[chr17:1509125-1509668]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 1509158 rs145370193 G A 4695241
chr17 1509159 rs12453258 G A 4695242
chr17 1509181 rs149212346 C T 4695243
chr17 1509202 rs187865740 C T 4695244
chr17 1509319 rs76997747 G A 4695245
chr17 1509411 rs9903662 C T 4695246
chr17 1509423 rs529740169 AGACCCTCCAGAGCTGGCCGGGGGCCACCGCGGGACCCTCTCCTG A 4695247
chr17 1509453 rs570579858 C T 4695248
chr17 1509460 rs539299509 C T 4695249
chr17 1509467 rs556485641 G A 4695250
chr17 1509567 rs572360466 G A 4695251
chr17 1509631 rs78331739 C G 4695252
Genes possibly regulated by ZNF274[chr17:1509125-1509668]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:1509125-1509668]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results