Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 2290037 2302995 enh4210
chr17 2300026 2300553 vista23713

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 2300370 rs563436641 A G 4701637
chr17 2300451 rs528501987 C T 4701638
chr17 2300489 rs534542456 TCCAGTGCGGGGAGGCCTTAGGTTACGCCCGGGAGAAAA T 4701639

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 2287354 2304412 - MNT ENSG00000070444.10 2304412 0.64 1.0 3839 15238


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results