Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
---|---|---|---|---|---|
chr17 | 2290037 | 2302995 | enh4210 |
|
|
chr17 | 2300026 | 2300553 | vista23713 |
|
Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr17 | 2300370 | rs563436641 | A | G | 4701637 | |
chr17 | 2300451 | rs528501987 | C | T | 4701638 | |
chr17 | 2300489 | rs534542456 | TCCAGTGCGGGGAGGCCTTAGGTTACGCCCGGGAGAAAA | T | 4701639 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|---|---|---|---|---|---|---|---|---|---|---|
chr17 | 2287354 | 2304412 | - | MNT | ENSG00000070444.10 | 2304412 | 0.64 | 1.0 | 3899 | 15238 |
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|