Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 7738145 7747135 enh4233
chr17 7745337 7745870 vista23886
chr17 7745915 7746944 vista23887

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 7745722 rs374382652 C G 4731428
chr17 7745965 rs147914313 C T 4731429
chr17 7746182 rs114555032 C T 4731430
chr17 7746301 rs565941309 AGGGCTTTGTATTCTTGGGTGCTGGCGTG A 4731431
chr17 7746379 rs543493127 C CA 4731432
chr17 7746522 rs58527948 C T 4731433

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results