| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr17 | 7738145 | 7747135 | enh4233 |
|
|
| chr17 | 7745915 | 7746944 | vista23887 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr17 | 7746182 | rs114555032 | C | T | 4731430 | |
| chr17 | 7746301 | rs565941309 | AGGGCTTTGTATTCTTGGGTGCTGGCGTG | A | 4731431 | |
| chr17 | 7746379 | rs543493127 | C | CA | 4731432 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|