EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr17:30830319-30831459]
Chromosome characteristics of ZZZ3[chr17:30830319-30831459]
Back to top
Enhancers possibly regulated by ZZZ3[chr17:30830319-30831459]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 30828061 30836895 enh44411
Blood (T-cell) Esophagus Blood (GM12878) Peripheral Blood (MM.1S) Muscle (Myoblast) Muscle (Myotube) Thymus Stomach
chr17 30830584 30830931 vista24433
VISTA
SNP sites on ZZZ3[chr17:30830319-30831459]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 30830583 rs139110100 T G 4831105
chr17 30830778 rs143138701 T C 4831106
chr17 30830800 rs73274238 T G 4831107
chr17 30830824 rs144777050 A G 4831108
chr17 30830856 rs571696313 T C 4831109
chr17 30830983 rs186834902 G T 4831110
chr17 30831028 rs148150618 C T 4831111
chr17 30831029 rs183373225 G A,C 4831112
chr17 30831245 rs1015308 C T 4831113
chr17 30831320 rs9892116 A G 4831114
chr17 30831383 rs150680595 T C 4831115
chr17 30831395 rs561687205 C T 4831116
chr17 30831441 rs547102064 AGGATGACCCGGGCCCAAGCTCGT A 4831117
Genes possibly regulated by ZZZ3[chr17:30830319-30831459]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr17:30830319-30831459]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results