Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 30828061 30836895 enh44411
chr17 30830584 30830931 vista24433

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 30830983 rs186834902 G T 4831110
chr17 30831028 rs148150618 C T 4831111
chr17 30831029 rs183373225 G A,C 4831112
chr17 30831245 rs1015308 C T 4831113
chr17 30831320 rs9892116 A G 4831114
chr17 30831383 rs150680595 T C 4831115
chr17 30831395 rs561687205 C T 4831116
chr17 30831441 rs547102064 AGGATGACCCGGGCCCAAGCTCGT A 4831117
chr17 30831522 rs11867240 G C 4831118
chr17 30831528 rs141198309 GGGGT G 4831119
chr17 30831528 rs368245504 GGGGT G 4831120

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results