Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 39651125 39655275 enh81209
chr17 39653134 39653351 vista24772

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 39653065 rs551499622 G A,C 4872885
chr17 39653065 rs576305077 G GGCCAGGACTGGGTCTAGGGCCCA 4872886
chr17 39653121 rs115573575 T C 4872887
chr17 39653122 rs7222980 T C 4872888
chr17 39653212 rs57333321 C T 4872889
chr17 39653215 rs73983500 T C 4872890

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results